- Category:
- Other systems
- Tags:
-
- File Size:
- 12kb
- Update:
- 2015-01-01
- Downloads:
- 0 Times
- Uploaded by:
- Allie
Description: File 1:> 1_NC_008467ATGACCTACAAAAGGTCACCTTGGATGTTTGG GAACGATGCATGATAGGTTTC CCTGGAAGCTAA> 2_NC_008467 AAAATGATACTTGTGTCCTTATGAAAAGTCTATA CATTAGGCATTTCATGTAGCATAA> 3_NC_008467ATGGCAGAAAATAAGGAGCATTGGCTAGAGCAGGGTACCAACATGGAACAGTTGGTCATGCATATGGAATTACTGTCCACTCAATTCCATAGATGA file 2: Start terminate 1_NC_008467 20 502_NC_008467 5 203_NC_008467 11 60 Requirements: 2 years with the file information extraction sites in a sequence in the file. 2, the first file as gene name, and the second as the start site, and the third as a termination site. The results 1.txt (extraction sites before the start sequence) ATGACCTACAAAAGGTCACC AAAATATGGCAG
To Search:
File list (Check if you may need any files):
perl.docx
Download